Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Zaiton Abdul Kadir, Fauzi Daud, Azhar Mohamad, Sahidan Senafi, Ferlynda Fazleen Jamaludin

Research output: Chapter in Book/Report/Conference proceedingConference contribution

Abstract

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5′ TCTTGGCGAGTTCGAAGAAT 3′; BGR3: 5′ TTCCGATCTTGGTCTGGAAG 3′) was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 μl of 10× PCR buffer, 1.5 μl of 25 mM MgCl2, 1 μl of 10 mM dNTP, 1 μl of β-glucan primers, 0.1 μl of 5 units/ml Taq polymerase and 2 μl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Original languageEnglish
Title of host publication2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium
PublisherAmerican Institute of Physics Inc.
Volume1678
ISBN (Electronic)9780735413252
DOIs
Publication statusPublished - 25 Sep 2015
Event2015 Postgraduate Colloquium of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology, UKM FST 2015 - Selangor, Malaysia
Duration: 15 Apr 201516 Apr 2015

Other

Other2015 Postgraduate Colloquium of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology, UKM FST 2015
CountryMalaysia
CitySelangor
Period15/4/1516/4/15

Fingerprint

primers
genes
deoxyribonucleic acid
optimization
biopolymer denaturation
markers
cycles
Malaysia
annealing
polysaccharides
activity (biology)
elongation
temperature gradients
templates
screening
buffers
alignment
computer programs
products

ASJC Scopus subject areas

  • Physics and Astronomy(all)

Cite this

Kadir, Z. A., Daud, F., Mohamad, A., Senafi, S., & Jamaludin, F. F. (2015). Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious. In 2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium (Vol. 1678). [030031] American Institute of Physics Inc.. https://doi.org/10.1063/1.4931252

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious. / Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen.

2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium. Vol. 1678 American Institute of Physics Inc., 2015. 030031.

Research output: Chapter in Book/Report/Conference proceedingConference contribution

Kadir, ZA, Daud, F, Mohamad, A, Senafi, S & Jamaludin, FF 2015, Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious. in 2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium. vol. 1678, 030031, American Institute of Physics Inc., 2015 Postgraduate Colloquium of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology, UKM FST 2015, Selangor, Malaysia, 15/4/15. https://doi.org/10.1063/1.4931252
Kadir ZA, Daud F, Mohamad A, Senafi S, Jamaludin FF. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious. In 2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium. Vol. 1678. American Institute of Physics Inc. 2015. 030031 https://doi.org/10.1063/1.4931252
Kadir, Zaiton Abdul ; Daud, Fauzi ; Mohamad, Azhar ; Senafi, Sahidan ; Jamaludin, Ferlynda Fazleen. / Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious. 2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium. Vol. 1678 American Institute of Physics Inc., 2015.
@inproceedings{5a74f3548ff74d4c9cf04d8d257ba3f6,
title = "Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious",
abstract = "Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5′ TCTTGGCGAGTTCGAAGAAT 3′; BGR3: 5′ TTCCGATCTTGGTCTGGAAG 3′) was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 μl of 10× PCR buffer, 1.5 μl of 25 mM MgCl2, 1 μl of 10 mM dNTP, 1 μl of β-glucan primers, 0.1 μl of 5 units/ml Taq polymerase and 2 μl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.",
author = "Kadir, {Zaiton Abdul} and Fauzi Daud and Azhar Mohamad and Sahidan Senafi and Jamaludin, {Ferlynda Fazleen}",
year = "2015",
month = "9",
day = "25",
doi = "10.1063/1.4931252",
language = "English",
volume = "1678",
booktitle = "2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium",
publisher = "American Institute of Physics Inc.",

}

TY - GEN

T1 - Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

AU - Kadir, Zaiton Abdul

AU - Daud, Fauzi

AU - Mohamad, Azhar

AU - Senafi, Sahidan

AU - Jamaludin, Ferlynda Fazleen

PY - 2015/9/25

Y1 - 2015/9/25

N2 - Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5′ TCTTGGCGAGTTCGAAGAAT 3′; BGR3: 5′ TTCCGATCTTGGTCTGGAAG 3′) was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 μl of 10× PCR buffer, 1.5 μl of 25 mM MgCl2, 1 μl of 10 mM dNTP, 1 μl of β-glucan primers, 0.1 μl of 5 units/ml Taq polymerase and 2 μl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

AB - Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5′ TCTTGGCGAGTTCGAAGAAT 3′; BGR3: 5′ TTCCGATCTTGGTCTGGAAG 3′) was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 μl of 10× PCR buffer, 1.5 μl of 25 mM MgCl2, 1 μl of 10 mM dNTP, 1 μl of β-glucan primers, 0.1 μl of 5 units/ml Taq polymerase and 2 μl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

UR - http://www.scopus.com/inward/record.url?scp=85006207074&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85006207074&partnerID=8YFLogxK

U2 - 10.1063/1.4931252

DO - 10.1063/1.4931252

M3 - Conference contribution

VL - 1678

BT - 2015 UKM FST Postgraduate Colloquium: Proceedings of the Universiti Kebangsaan Malaysia, Faculty of Science and Technology 2015 Postgraduate Colloquium

PB - American Institute of Physics Inc.

ER -